Find the expected PCR product size from a DNA template, forward primer, and reverse primer. The calculator reports primer binding sites, amplicon coordinates, product GC content, basic primer Tm values, and multiple-product warnings.
Paste your template and primer sequences. Results update instantly as the primer pair changes.
Load a clean product, a longer amplicon, or a multiple-site example. All results update as you edit the sequences.
Paste the strand you want to search. The calculator removes spaces, line breaks, and numbering.
Length
109
GC
53.2%
Matches
1
Enter both primers 5′ to 3′. The reverse primer is automatically reverse-complemented before template matching.
Reverse-primer binding sequence on template
TACGATCGTACCGTAA
Live PCR result
The product spans template bases 12 to 109, including both primer-binding regions.
Amplicons
1
Product GC
52.0%
Tm gap
2.6°C
Forward primer
ATGACCAAGTTCGACG
Length: 16 bases
GC: 50.0%
Basic Tm: 43.4 °C
Reverse primer
TTACGGTACGATCGTA
Length: 16 bases
GC: 43.8%
Basic Tm: 40.8 °C
Exact-match products appear only when the forward primer binds upstream of the reverse-primer binding site.
| Product | Forward start | Reverse start | Coordinates | Length | GC% |
|---|---|---|---|---|---|
| Product 1 | 12 | 94 | 12–109 | 98 bp | 52.0% |
The preview highlights the first 80 bases of the predicted PCR product.
ATGACCAAGTTCGACGATGCTACCGGATCCGTTACGGTACCGGTTAGCTAGGATCCTAACCGGTACCGTAACGGATCGATCGTACGATCGTACCGTAA
PCR product size is the length of the DNA fragment amplified between a forward primer and a reverse primer. The value includes both primer sequences and the internal template region. Molecular biologists often call this fragment an amplicon.
Kary Mullis developed polymerase chain reaction in the 1980s, and PCR rapidly became a core method for cloning, diagnostics, sequencing preparation, and genotyping. The National Human Genome Research Institute describes PCR as a fast technique that amplifies small DNA segments for analysis. Read the NHGRI PCR fact sheet.
Product size depends on primer position and orientation. A forward primer must bind upstream of the reverse-primer binding sequence. DNA polymerase then extends each primer in the 5′ to 3′ direction, producing a fragment bounded by those sites.
Enter the template strand as A, C, G, and T bases. The calculator removes spaces, line breaks, and numbering.
Type the forward primer in 5′ to 3′ orientation so the tool can find its exact site on the template strand.
Type the reverse primer in 5′ to 3′ order. The calculator reverse-complements it before matching the template.
Use the result banner, product table, and diagram to check product length, coordinates, Tm gap, and multiple-product warnings.
The template box stores the DNA strand searched for primer-binding sites. The calculator cleans FASTA-style spacing and numbering, then keeps only A, C, G, and T bases. Use the GC Content Calculator when you need a separate sequence-composition check before primer design.
The primer pair card accepts the forward and reverse primers in 5′ to 3′ order. The reverse-primer binding display shows the reverse complement that the calculator actually searches on the template. This helps users catch the most common orientation mistake.
The result banner reports the shortest valid forward-to-reverse amplicon first. The primer quality cards show length, GC percentage, and a basic Tm estimate. For reaction-condition-sensitive Tm work, compare the same primers in the DNA Melting Temperature Tm Calculator.
The product table lists every exact-match amplicon found in the template. Multiple products suggest repeated binding sites, so you should inspect primer specificity with the Oligo Analyzer before ordering primers.
Primer orientation decides whether PCR can amplify a region. The forward primer binds one strand and points toward the target. The reverse primer binds the opposite strand and also points toward the target after reverse-complement matching.
Coordinates work like a ruler on the pasted template. If the forward primer starts at base 25 and the reverse-primer binding site ends at base 164, the expected product length equals 140 bp. This full count includes the primer sequences because they become part of the final amplified DNA.
| Component | Direction entered | Template search | Why it matters |
|---|---|---|---|
| Forward primer | 5′→3′ | Exact sequence | Defines the left edge of the amplicon. |
| Reverse primer | 5′→3′ | Reverse complement | Defines the right edge of the amplicon. |
| PCR product | Forward-to-reverse | Between primer sites | Predicts the gel band size in base pairs. |
A forward primer begins at base 10 and a reverse-primer binding site ends at base 105. Product size equals 105 − 10 + 1, so the expected PCR band is 96 bp. This product should appear as one clean band when both primers bind uniquely.
A template contains two forward-primer sites and one reverse-primer binding site. The calculator can return two possible products, such as 120 bp and 285 bp. In a gel, that design may create two bands unless one site fails under the chosen annealing conditions.
Product-size prediction helps before ordering primers. Cloning workflows need the correct insert length. Sanger sequencing needs a product that covers the target but still produces clean reads. Genotyping assays often use size differences to separate alleles on agarose or capillary systems.
Amplicon length also affects amplification efficiency. Short products amplify faster and often work better with degraded DNA. Longer products can capture more sequence context, but they demand stronger template quality, longer extension time, and suitable polymerase chemistry.
This calculator uses exact sequence matching. It does not score mismatches, secondary structure, primer dimers, genomic repeats outside the pasted template, or polymerase-specific extension limits. Those factors can change the result in real assays.
Treat the output as a product-size prediction from the sequence you pasted. For clinical, forensic, diagnostic, or regulated laboratory work, validate primer specificity with an accepted alignment workflow and local assay controls.
Use these molecular tools to refine primer design after you calculate the expected amplicon size.