Forward self-dimer
Risk: Low
- Longest run
- 4 bp
- 3′ run
- 1 bp
- GC pairs
- 2
- Approx. ΔG
- -7.0
Primer Dimer Calculator for PCR and qPCR
Check a forward and reverse primer pair for self-dimers, hetero-dimers, 3′ complementarity, GC content, and Tm balance. Use Basic mode for a fast screen. Use Advanced mode when primer concentration, salt, or qPCR sensitivity changes the risk.
Primer dimer calculator with self-dimer and hetero-dimer checks
Paste primers in 5′ to 3′ orientation. The calculator scans anti-parallel complementarity and flags runs that can produce primer-dimer bands or qPCR melt peaks.
Choose primer dimer analysis mode
Basic mode screens a primer pair fast. Advanced mode adds concentration, salt, alignment, and assay warnings.
Forward primer input
Paste the forward primer in 5′ to 3′ orientation. Non-DNA characters are ignored.
Length
20 nt
GC%
45.0%
Tm
44.6°C
Forward primer bases
ATGACCATGATTACGCCAAG
Reverse primer input
Paste the reverse primer as ordered from the vendor, also written 5′ to 3′.
Length
20 nt
GC%
50.0%
Tm
46.7°C
Reverse primer bases
GCTTACAGGATCGTCAACGA
Live primer-dimer result
High primer-dimer risk
Worst signal: Reverse self-dimer. Longest complementary run is 4 bp, with 4 bp at a 3′ end.
The strongest warning comes from 3′ complementarity. Polymerase can extend this kind of primer-dimer.
Reverse self-dimer
Risk: High
- Longest run
- 4 bp
- 3′ run
- 4 bp
- GC pairs
- 2
- Approx. ΔG
- -7.0
Forward + reverse hetero-dimer
Risk: Moderate
- Longest run
- 4 bp
- 3′ run
- 3 bp
- GC pairs
- 2
- Approx. ΔG
- -7.0
Best dimer alignment
The lower line shows the reverse-complement orientation used for primer pairing.
Query 5′ GCTTACAGGATCGTCAACGA 3′
| | | |
Partner 3′ TCGTTGACGATCCTGTAAGC 5′Primer pair quality checks
- Tm difference: 2.0°C. This looks well matched.
- GC range: Both primers sit inside the usual 40–60% target.
- Primer length: Both primers sit inside the common 18–30 nt design range.
- Concentration note: Primer concentration looks typical for endpoint PCR or qPCR.
Design suggestions
- Move one primer a few bases upstream or downstream if the 3′ run reaches 4 bp or more.
- Reduce strong GC pairing at the 3′ end when the assay forms non-specific qPCR melt peaks.
- Keep primer Tm values close enough that both primers anneal during the same PCR step.
- Use a no-template control when primer-dimer risk looks moderate or high.
Primer dimer calculator: what the result means
A primer dimer forms when PCR primers anneal to each other instead of the target DNA. The risky version occurs at the 3′ end, because DNA polymerase can extend that paired end. A primer pair can look perfect by length and GC content, yet still fail because the two 3′ tails bind each other.
This calculator tests three events: forward self-dimer, reverse self-dimer, and forward-reverse hetero-dimer. It also reports GC%, approximate Tm, 3′ clamp behavior, and the best alignment that explains the warning. IDT’s oligo-analysis workflow also separates hairpin, self-dimer, and hetero-dimer checks, which matches the same design logic used here. Review IDT OligoAnalyzer features.
Use the result as a screening step before ordering primers or setting up qPCR. A low-risk score does not guarantee perfect amplification. A high-risk score tells you to redesign at least one primer before you spend reagents.
How to use Primer Dimer Calculator for PCR primer design
- 1
Paste the forward primer sequence
Enter the forward primer in 5′ to 3′ orientation. The tool removes spaces and ignores non-DNA characters.
- 2
Paste the reverse primer sequence
Enter the reverse primer as ordered from the oligo vendor. Do not reverse-complement it before pasting.
- 3
Review self-dimer and hetero-dimer risk
Check the longest complementary run and the 3′ complementary run for each primer and primer pair.
- 4
Use Advanced mode for assay context
Add primer concentration, salt, and amplicon length to judge qPCR or PCR risk more carefully.
Primer Dimer Calculator components and purpose
Forward primer input
Screens one oligo for self-dimer risk and gives length, GC%, and Tm.
Reverse primer input
Checks the second primer exactly as ordered, written 5′ to 3′.
Hetero-dimer result
Shows whether the forward and reverse primers can anneal to each other.
3′ run length
Highlights complementarity that DNA polymerase can extend.
Advanced settings
Adds salt, concentration, amplicon length, and alignment display.
Primer dimer interpretation table for PCR and qPCR
Low risk
The primer pair shows no strong 3′ complementarity. Routine PCR should still include a negative control.
Moderate risk
A run of 3–4 bases or a stable internal match may cause faint primer-dimer bands.
High risk
A 3′ complementary run can create extendable primer-dimer products. Redesign one primer.
The National Institute of Justice primer-design guidance warns against complementarity between primers, especially at the 3′ end, because it can create amplified primer-dimers and primer-oligomers. Read the primer-complementarity guidance.
Primer dimer calculator examples for real assay decisions
Example 1: qPCR primer pair with a clean no-template control
A qPCR assay uses a 96 bp amplicon, a 23 nt forward primer, and a 22 nt reverse primer. The calculator reports 48–52% GC, a Tm difference below 2°C, and no 3′ run longer than 2 bp. That pair deserves a low-risk label.
You would still run a no-template control. If the melt curve shows one target peak and no early NTC amplification, the primer design likely supports reliable relative expression analysis.
Example 2: PCR pair with a 4 bp 3′ dimer
A second primer pair shows a 4 bp complementary run at the reverse primer 3′ end. The run contains two G·C pairs, so the small duplex can hold long enough for extension. The calculator labels the pair moderate or high risk, depending on the full alignment.
Redesign the reverse primer first. Shift it three to five bases when the target region allows it. Then check the new pair with the DNA melting temperature calculator before setting annealing temperature.
Primer dimer prevention workflow before ordering primers
Start with target specificity, then check primer physics. Choose primers that match the target locus, avoid long homopolymer runs, keep GC content near the usual 40–60% range, and keep Tm values close. After that, run dimer and hairpin screens.
A primer pair that passes this page should still fit the full PCR setup. Use the PCR master mix calculator when you need final primer concentration and reaction-volume planning. Use the hairpin calculator when one primer contains internal complementarity that may form a stem-loop.
Related primer and PCR tools
Hairpin Calculator
Check intramolecular stem-loop structures in the same oligo before ordering primers.
DNA Melting Temperature Tm Calculator
Estimate primer Tm from sequence and reaction conditions before choosing an annealing temperature.
PCR Master Mix Calculator
Plan reaction volumes after you choose primer concentrations and final PCR setup.
Primer Dimer Calculator FAQs
What does a primer dimer calculator check?
A primer dimer calculator checks whether one primer can bind to itself or to the other primer in a PCR pair. The most important warning comes from complementarity at the 3′ end. DNA polymerase can extend a paired 3′ end, so a short 3′ dimer can create amplified primer-dimer products. This calculator reports self-dimer risk, hetero-dimer risk, longest complementary run, 3′ run length, GC content, and approximate Tm balance.
How many complementary bases make a primer dimer risky?
Four or more complementary bases at a primer 3′ end deserve attention. Three bases can still matter when the run contains several G·C pairs or when primer concentration is high. Long internal runs also matter because they can stabilize primer pairing before the 3′ end aligns. Treat the result as a design screen, then confirm with a no-template control and melt-curve data for qPCR.
Why does 3 prime complementarity matter more than internal complementarity?
DNA polymerase extends from the free 3′ hydroxyl group. If two primers bind at their 3′ ends, polymerase can copy one primer using the other primer as a short template. That reaction creates a primer-dimer amplicon even when the target DNA is absent. Internal complementarity can still reduce efficiency, but it usually causes less trouble than an extendable 3′ dimer.
Can primer dimers affect qPCR Ct values?
Yes. SYBR Green and other intercalating dyes detect any double-stranded DNA, including primer-dimer products. A primer dimer can lower Ct values, distort standard curves, and create an extra melt-curve peak. Probe-based qPCR can tolerate some non-specific products better, but primer-dimer formation still consumes primers and polymerase. Always inspect no-template controls when the calculator reports moderate or high risk.
What GC content should PCR primers have?
Many PCR primers work best around 40–60% GC content. A primer below that range can anneal weakly, while a very GC-rich primer can form stable secondary structures. The 3′ end often benefits from one or two G or C bases, but too much 3′ GC complementarity between primers can trigger dimers. This calculator checks GC percent and 3′ clamp behavior together.
Does this calculator replace thermodynamic primer-design software?
No. This calculator gives a fast educational screen for self-dimer, hetero-dimer, and 3′ complementarity. Full thermodynamic tools use nearest-neighbor parameters, oligo concentration, salt, magnesium, and modified bases. Use this page to catch obvious problems before you order primers. Use a dedicated oligo-analysis program for final ordering decisions when the assay costs time or money.
How do I fix a primer pair with high dimer risk?
Move one primer a few bases upstream or downstream first. That small shift often breaks a 3′ complementary run without changing the amplicon too much. You can also reduce excessive 3′ GC pairing, adjust primer length, or pick a nearby target region. For qPCR, keep the amplicon short and test no-template controls before trusting expression data.